Cavy because it requires little capital, provides quality and

Cavy is a promising livestock especially in sub-Saharan Africa because it
requires little capital, provides quality and cheap meat 31, 16, can be afford by poor people. Cavies are early and prolific 10, 16, when subjected to adequate nutrition and clean environment, they
reproduce rapidly with less health care compared to other species such as
rabbits 31,
16, and therefore constitute a guarantee of food security 29. In most countries of the Great Lakes regions,
cavies are predominantly higher than rabbits or pigs 23, 17. They are well suited to family farming systems where they would
constitute with the rabbit the major source of animal protein for family consumption,
other species serving as source of income for the household 23, 17, 16.

In eastern DRC, it is currently kept by eight out of ten households,
with numbers ranging from 6 to 30 19, 23. This agrees with
previous observations by Schoepf and Schoepf 34, who reported about one third of surveyed households in DRC. Previously consumed exclusively by children,
it has become a source of protein for all categories since the 1990s 43, 24. In urban areas, however, consumption remains limited due to the
accessibility and consideration of cavies as an animal of poor 17, 18, 19. In sub-Saharan Africa, despite the benefits of cavy
husbandry in the socio-economic at household level, their population remains
poorly documented, as they are not included in national census except in
Tanzania 28. Cavy population in DRC is estimated to be more than 2 million,
contributing significantly to nutrition security, especially for animal
protein, and income generation of more than a hundreds of thousands of poor
rural and urban households 17. The largest cavy populations are
kept in the Kivu provinces, where they are part of ‘rehabilitation kits’ of
humanitarian NGOs and because they are included in the agricultural portfolio
of development agencies who seek to address the challenges of widespread hunger
and malnutrition in the area 17. However, despite the role of caviaculture
in the household livelihood, their history remains unknown and not documented.
Recent research on diversity assessment indicated the existence of three genes
pools in the country. However there were limitation on gene flow for better
caption of the genetic diversity that can guide improvement strategies (Ayagirwe
et al., unpublished data).  Although it
is believed that cavies were introduced into Africa by missionaries during the
colonial period. Cavy production system has evolved leading to enormous changes
in their production and genetic diversity 22, 25, 29.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

The origin of cavies
in DR Congo is currently unknown. It is thought that the first cavies were kept
in the catholic convents led by Belgian and Italian Jesuit missionaries, around
early 20th century when the Catholic Church was established in Bushi area in
Sud-Kivu 30. However that history relayed on information assembled
by word-of-mouth and gathered over decades in discussions with old (± 80 years)
key informants from different villages as no known written records exist on the
history of cavy culture anywhere in DRC 17, as it is the case of
other African countries like Cameroon 48. In this work we proposed
to assess the phylogeny and evolution story of cavy raised for meat consumption
in DRC using the very conservative region of the cytochrome b gene. The
objective of this work was 1) to assess the phylogenetic position of the DR
Congo cavies populations, in order to discern if all share a common origin or
if they are the result of independent evolutionary events, and 2) to evaluate
the evolutionary affinities among the DRC Cavies and others American and
European populations, in order to test previous hypotheses that suggest a close
relationship among them. 

1.    Methodology

1.1.       
Sampled area   

The sampling zone belongs to four different provinces of RD Congo. Located
on both sides of the Equator, extending between 5° 20′ north latitude and 13°
50′ south latitude, between 12° 15’and 31° 15 ‘east longitude. Its natural
environment consists of the essential factors that contribute to the quality
and variety of agro-pastoral potential and offer an ecosystem conducive to the
promotion and sustainable development of plant and animal production. There are
four climatic zones: (i) the equatorial zone at the center, with a warm and
humid climate, temperatures varying between 20°c and 32°C, heavy precipitation
exceeding 2,000 mm per year regularly distributed throughout the year; (ii) the
tropical zones, with two very marked seasons as one moves away from the
Equator.  These are: (a) the rainy season, characterized by precipitation
ranging from 800 to 1,500 mm per year and fluctuating temperatures between 25°
and 33°c; (b) the dry season, which can last from 1 – 3 months in the North and
from 1 to 6 months (of dry season), in the South, with temperatures ranging
from 17° to 25°C. (iii) the monsoon climate transition zone, separating humid
equatorial and tropical climates, and (iv) the relatively temperate zone in the
eastern part of the country with special rainfall conditions (on average 60 mm
per month), with temperatures varying between 8°C and 18°c due to the elevation
of the relief. The different sampled areas are shown in figure 1.

Blood samples were
collected from 96 adults in four provinces of the DRC, 24 samples per region
(South and North Kivu, Katanga and Kinshasa) based on their phenotypic
variability, geographic distance location and genetic distance. Blood samples
from each animal was collected from ears and stored on FTA cards (Whatman® FTA®
card technology, Sigma-Aldrich).

1.2.       
Total DNA extraction
and PCR amplification

Total DNA extraction
was carried out at BecA-ILRI Hub using FTA™ Purification Reagent according to
the manufacturer’s protocol. A pairs of primers were designed based on the
cytochrome b gene of the cavy reference sequence NC_000884.1 (D’Erchia et al.,
1996) deposited in GenBank. Primer pairs were designed (Froward:
GCATCTGTCTAGGCCTGCAA and Reverse: GGTTGGCGGGTGTGTAGTTA) to cover variable
regions of the cytochrome b gene, with the primers situated in conserved
region. The amplification products ranged from 600 to 670 base pairs after
trimming.

The PCR amplification
was done in a 50 µl reaction volume containing 45 ng DNA, 1X AccuPower PCR
Master Mix (Bioneer, Korea), 0.09ng of each primers and 0.5 mM of MgCl2
as top up. PCR amplification was performed in a GenAmp ® 9700 PCR system
Thermal Cycler (Applied Biosystems) using the following thermal cycling conditions:
initial denaturation of 5 min at 95°C followed by 35 cycles of 45s denaturation
at 94°C, 60s primer annealing at 58°C and 1 min primer extension at 72 °C, and
then a final extension step of 15 min at 72 °C. PCR product were then evaluated
using 1.8% agarose gel on electrophoresis. Prior to sequencing, amplified
products were purified using a quick-start protocol
of Qiagen Qiaquick® Gel Extraction Kit as recommended by the manufacturer
(QIAGEN Inc.) and visualized on 0.8% agarose gels. Samples were sequenced using
the BigDye Terminator v3.1 Cycle Sequencing Chemistry (Applied Biosystems) and
the ABI Prism 3130XL automatic capillary sequencer (Applied Biosystems, USA)
following the manufacturers recommendations by using the same primers set as
described above.

1.3.       
Data Analysis

Sequences were assembled
and trimmed using the CLC Main Work bench 7.8.1. Both strands of all sequences
were obtained and after blast and conflict resolution, they were free of
indels, premature stop codons and ambiguities in forward and reverse
directions, providing support for their mitochondrial origin 40.

Phylogenetic analyses

To evaluate the DRC
cavy population phylogeny, two representatives of the Mus famulus, one of the
Oryctolagus cuniculus and one of the Caprolagus hispidus downloaded from NCBI
genbank were include as outgroup taxa. Ten sequences of wild cavies from
genbank have been as well used to evaluate the relationship between DRC cavies
with their closely related: Cavia tshudii (2), C. magna (2), C. fulgida (2), C.
apera (2) and C. patzelti (2). However to compare domestic cavies from DRC with
other cavy populations, 18 sequences have been downloaded from the NCBI genbank
(one from Europe, six from Colombia, five from Peru, two from Chili, three from
Bolivia and one from Ecuador). Details for the downloaded sequences are given
in table 1.

Multiple alignments
were first performed and displayed using the Mega6 39, then
carefully examined and manually edited to maximize the overall similarity. The
Bayesian Information Criterion were used to describe the best evolutionary
model for these data. Akaike Information Criterion identified the Kimura 2-parameter model taking into account
the proportion of invariable sites and following a gamma distribution for
variable sites as most appropriate fit to our data 11 due to its lowest maximum log likelihood (-1195.4608) and lowest
Bayesian Information Criterion (4941.856) with the highest Akaike Information
Criterion identified (2855.565). The tree with the highest log likelihood is
shown. The percentage of trees in which the associated taxa clustered together
is shown next to the branches. Initial tree(s) for the heuristic search were
obtained by applying the Neighbor-Joining method to a matrix of pairwise
distances estimated using the Maximum Composite Likelihood (MCL) approach. A
discrete Gamma distribution was used to model evolutionary rate differences
among sites. The tree is drawn to scale, with branch lengths measured in the
number of substitutions per site. 1000 bootstrap have been used and the
analysis involved a total of 634 positions in the final dataset. Evolutionary
analyses were conducted in MEGA6 39.

2.    Results

2.1.       
Phylogenetic relationship between DRC Cavies and
their relatives wild cavies

The
phylogenetic tree based on genetic distances and reconstructed by NJ is shown in
Fig.2. The topology reported shows three major clusters, one including domesticated
cavies from DR Congo with their closely related Cavia utschudii with
relatively high bootstrap values. One with only Cavia magna (100 bootstrap value) and the third comprising Cavia apera, C. fulgida and C. patzelti although bootstrap support
for this clade was relatively low (Fig. 2). 
It appears that the studied DRC cavy population clustered far apart from
the wild cavies and are only related with C.
utschudii (bootstrap value more varying between 80 and 100%). The different
wild cavies are distinctly different from one another based on the length of
the branches. In DRC population however there is sub-clustering of the
domesticated cavies which shows relatively two groups (bootstrap value = 60%).

 

2.2.       
DRC Cavy population
phylogeny compared to their clothier taxa

The figure 3, based
on genetic distances and reconstructed by NJ, it indicates that there is three
clusters. A clear differentiation is observed between cavy populations from DRC
and two others clusters comprising of the Mus
famulus and the Oryctolagus cuniculus
clustered with Caprolagus hispidus. However on that phylogeny tree
it appears that cavy populations are more clothier to mouse than they do for
rabbit.  All the cavies from DRC
clustered in a unique big cluster with 99% bootstrap value. Between the DRC cavy
population cluster, there is existence of sub-clustering. However, that
clustering is not due to cavy population origin. Some individuals from Kinshasa
clustered far apart from the rest of the group with 60% bootstrap value. The
existence of the admixture of cavy individuals from different regions implies
the evidence of sharing the same genetic background and the exchange at a
certain level of the genetic materials. The low genetic distance exiting
between these populations.

2.3.       
DRC Cavy population
relationship compared to other Latin American domesticated cavy populations

The history of cavy introduction in DR Congo is not known.
Their origin is however speculated as well as the introduction and
dissemination route. It is believed that they came from South America but the
real country of origin is not yet clearly established. We considered cavies
from six Latin American countries (Peru, Colombia, Chili, Ecuador, Bolivia and
Argentina) and from Europe to trace the dissemination route and probable
country of origin. From the figure it appears that all DRC cavies were
clustered with a pet cavy form Argentina and Europe as well as with some
individuals from Peruvian domestic cavy (with 66% confidence). The second
cluster belongs to cavies from Colombia which are as well clothier to DRC
cavies than the rest do. Some sequences of cavies from Chili, Bolivia, Peru and
Colombia clustered together and are the one very distant from the DRC sequences.
Possible existence of high genetic diversity exist in South America population
and only a narrow genetic material have moved to Europe during the immigration.
As it have been shown previously, the European specimens clearly originate from
South America; and suggestion that European cavies either originate from the
Caribbean or possibly directly from Colombia and Peru. It is as well clear that
cavies transited from Europe before introduction to Africa. The presence of
Argentina pet in the same cluster of DRC cavies and Europe is in accordance
with the migration purpose of cavy as laboratory and pet animal than the actual
use it deserve in Africa as source of meat for consumption.

2.4.       
Discussion

Cavies are reported to have been domesticated at least 4.500
years ago 33 in the highlands of South America providing the Indians
with meat and sacrificial animals. However, opinion still dived on the real
ancestor of Cavia porcellus as two
wild cavy were known to be related; C.
apera and C. utschudii. These two
wild cavies are known to reproduce with the domesticated cavies fertile
offspring 12,
13. Kruska and Steffen 12 observed when doing comparative allometric investigations
on the skulls of wild cavies (Cavia
aperea) versus domesticated cavies (C.
porcellus) that C. apera is the
ancestor of the domesticated cavies. “Cavia
tschudii” mainly distributed in Peru
and Chile being considered as a subspecies of the species Cavia aperea, which is widely distributed on the South American
continent. This have been based on configuration of the upper M3 occlusal
surface of all the wild Cavia aperea
including those from Andean regions but also from far northern and far eastern
distribution as well as of the domesticated cavies. When comparing chromosome 15, 45 as well as DNA investigations 41, these different authors suggested the origin of
domesticated cavies from Cavia aperea.

However, Recently Spotorno et al. 38, 35, 36 revitalized older assumptions, when investigating the
origin of domesticated cavies by use of molecular genetic methods as well as
skull measures and some other morphological traits. As a result they derived
all domesticated cavies from a species Cavia
tschudii with a distribution in the East Andean regions of Peru and
northern Chile rather than from the species Cavia
aperea of adjacent Bolivia.

In this study, domesticated cavies from DRC clustered with C. utshudii and far apart from C. apera while using cytochrome b gene
sequences. However phylogenetic inference determined that Cavia porcellus species share hereditary characteristics with para
phyletic group Cavia tschudii and Cavia aperea animals confirming Cavia porcellus offspring from Cavia tschudii 9.

The history of cavy introduction in DR Congo is not known.
Their origin is however speculated as well as the route of introduction. It is
believed that they came from South America but the real country of origin is
not yet clearly established. Two possible introduction to Africa are reported;
Blench 4, assumes that they have only been introduced by Christian
missionaries and colonial agricultural officers. Whereas Morales 26 suggests that the misnomer ‘Guinea pig’ may have inferred
from the European
assumption that cavies came from the
West African coast of Guinea after being imported from South America via the
Guinea slave trade ships. From this study, it appears that all DRC cavies were
clustered with a pet cavy from Argentina and Europe as well as with some
individuals from Peruvian domestic cavy. It is there clearly showed that domesticated
cavies in DRC were most likely from Peru and Colombia and have transited by
Europe before their introduction in Africa. This would suggest as well various
introduction of animals from the two countries. However, depending on their
small size characteristics they still comparable with their closely related
cavies (Criollos) which still be founded in rural areas in Latin America. The
present South American populations are probably the descendants of
pre-Columbian lineages. Whether Andean and laboratory/pet breeds are
genetically distinct is uncertain 37.
However Cavia porcellus have been
well-known domestic pets since their introduction to Europe in the sixteenth
century, from undocumented sources 46, 47; they became the prototype of laboratory models through the
nineteenth century 44. However they probably had a recent common ancestor around
the sixteenth century 44. In fact, molecular analyses of Peruvian cavies breeders 7 differentiate with the prolific, large-sized cavies
exhibiting a calm behavior (improved cavies), and the small-sized, nervous ones
(the “criollos” = creoles), typically found in rural houses 1, suggest
that improved cavies share a most recent common ancestor with the European cavy
which is not the ancestor of creoles 36.
Cavies brought to Europe were then subjected to further selective breeding
leading to the common domestic form that is nowadays used as pets and
laboratory animals 38. Their wild relative, the wild cavy (Cavia aperea) still is one of the most common and widespread
rodents of South America 2, 32.

Domesticated cavies follow a three-step process 38: a first ancient domestication 46, from the wild species to the domestic pre-Columbian cavy,
still bred as the ‘criollo’ (creole) breed throughout the Andean countries; a
second step involving European peoples, who took a few in the XVI century and
transformed them into the present worldwide laboratory/pet cavy 36; and a third step involving a modern selection regime of
creole cavies 7, to produce an improved animal for meat production known in
South American countries 26. This have been made possible, in recognition that cavies
can reproduce up to five generations per year 42 and concerning the length of the domestication period they
thus have lived under this influence for much more generations than have the
other domesticated lagomorphs and rodents and even than the other so?called classical domesticated forms (e. g., dog, sheep,
goat, cattle, pig, etc. 13) which led to very different cavies categories. From Europe
cavies have been then introduced to Africa during precolonial period.

However in DRC, the period of that introduction still
unknown. It has been conveyed that the first cavies were held in the catholic
convents in Sud-Kivu, led by Belgian and Italian Jesuit missionaries, probably
starting around the early 20th century, when the Catholic Church established
itself in the Bushi area 30. In the early colonial period, local people had no specific
interest in cavies. Though, some of those working in the convents introduced
the animal into their villages 27,
probably to supply meat to their children. Many people, however, thought cavies
were a kind of rat and, hence, adults scorned their children’s animal inside
the houses.

However, the chaos caused by the succession war for the
Mwami Kabare (1985-1987) resulted in widespread famine and high levels of
malnutrition, especially in children 21.
Then, cavies became considered as a ‘medical treatment’ for malnutrition,
particularly in overcoming anemia 27.
Some NGOs, such as Comité Anti-Bwaki5, recommended that children received cavy
blood, mixed with Coca Cola and tomato concentrate to overcome the condition.
The belief that cavy blood and meat has a health-improving effect especially
for children perpetuates until today, also in other parts of the country (B
Kajinga-Mutombo, pers. comm.).

In a survey conducted in the early 1980s in four mountainous
localities in Kabare territoire of Sud-Kivu near Mulungu, Schoepf and Schoepf 34 found that in one third of the 160 households visited,
older children raised cavies, which they consumed. This has to be seen in the
context where mothers usually leave starchy staples prepared in the home before
they leave to the fields; when children return from school, they prepare cavy
stew by themselves. The importance of cavy culture at that time in Kabare
territoire have been recognized based on its prevalence and its reported
contribution to animal-source protein provision for children 14. Cavies are described to be omnipresent in Mulamba
groupement in Walungu territoire, the large majority (83%) of 40 interviewed
households from four villages kept cavies successfully for a long time, meaning
at least since independence in the 1960s 27.

All DRC cavies were clustered in only one group with less
differentiation. When establishing a nucleus of cavies for a selection program
in the Institut supérieur agro-vétérinaire in Mont-Ngafula in Kinshasa in 2008,
populations were introduced from the Kivu provinces, Lubumbashi and different
villages and cities in the Bas-Congo province, such as Kimpese and Kisantu.
Strong cavy nuclei seem to thrive unnoticed in all these areas as very few
official reports are to be found that mention cavies 17. This movement of animal may be one of the raisons why DRC
cavy are closely related.

3.    Conclusion

The studied cavies
from DRC were less differentiated due to the animal exchange and genetic
introgression. The phylogenetic tree confirmed the hypothesis of C. utschudii being the ancestor of
domesticated cavies. The most plausible road of dissemination of cavies were
Latin America to Africa via Europe and not the direct introduction. Cavies
transited in Europe with the purpose of research and pet before being used as
meat source in Africa. That road of dissemination may reflect as well the gene
flow and would be tracked in improvement process. Possible existence of high genetic diversity exist in South
America population and only a narrow genetic material have been introduced to
DRC via Europe during the immigration.

4.   
Acknowledgements

We acknowledge the Biosciences eastern and central Africa –
International Livestock Research Institute (BecA-ILRI) Hub, through Africa
Biosciences Challenge Fund (ABCF) program for funding this work. The ABCF
Program is funded by the Australian Department for Foreign Affairs and Trade
(DFAT) through the BecA-CSIRO partnership; the Syngenta Foundation for
Sustainable Agriculture (SFSA); the Bill & Melinda Gates Foundation (BMGF);
the UK Department for International Development (DFID) and; the Swedish
International Development Cooperation Agency (Sida). The BESUP from the Eglise
du Christ au Congo (ECC) for supporting financially the field work. We thank as
well all cavy owners in DR Congo for providing unreserved access to their
animals for sampling.